Rosettacode tasks in Perl 6
  • Introduction
  • Programming tasks
    • 1
      • 10001th prime
      • 100 doors
      • 100 prisoners
      • 15 puzzle game
      • 15 puzzle solver
      • 16 puzzle game
    • 2
      • 2048
      • 21 game
      • 24 game
        • Solve
    • 4
      • 4-rings or 4-squares puzzle
    • 9
      • 99 bottles of beer
      • 9 billion names of God the integer
    • A
      • A* search algorithm
      • A B
      • Abbreviations automatic
      • Abbreviations easy
      • Abbreviations simple
      • ABC problem
      • ABC words
      • Abelian sandpile model
        • Identity
      • Abstract type
      • Abundant deficient and perfect number classifications
      • Abundant odd numbers
      • Accumulator factory
      • Achilles numbers
      • Ackermann function
      • Active Directory
        • Connect
        • Search for a user
      • Active object
      • Add a variable to a class instance at runtime
      • Addition-chain exponentiation
      • Addition chains
      • Additive primes
      • Address of a variable
      • ADFGVX cipher
      • Air mass
      • AKS test for primes
      • Algebraic data types
      • Align columns
      • Aliquot sequence classifications
      • Almkvist-Giullera formula for pi
      • Almost prime
      • Alternade words
      • Amb
      • Amicable pairs
      • Anadromes
      • Anagram generator
      • Anagrams
        • Deranged anagrams
      • Anaprimes
      • Angle difference between two bearings
      • Angles geometric normalization and conversion
      • Animate a pendulum
      • Animation
      • Anonymous recursion
      • Anti-primes
      • Apéry's constant
      • Append a record to the end of a text file
      • Append numbers at same position in strings
      • Apply a callback to an array
      • Apply a digital filter direct form II transposed
      • Approximate equality
      • Arbitrary-precision integers included
      • Archimedean spiral
      • Arena storage pool
      • Arithmetic
        • Complex
        • Integer
        • Rational
      • Arithmetic-geometric mean
        • Calculate Pi
      • Arithmetic coding
        • As a generalized change of radix
      • Arithmetic derivative
      • Arithmetic evaluation
      • Arithmetic numbers
      • Array concatenation
      • Array length
      • Arrays
      • Ascending primes
      • ASCII art diagram converter
      • ASCII control characters
      • Aspect oriented programming
      • Assertions
      • Assertions in design by contract
      • Associative array
        • Creation
        • Iteration
        • Merging
      • Atomic updates
      • Attractive numbers
      • Audio alarm
      • Audio frequency generator
      • Autogram checker
      • Average loop length
      • Averages
        • Arithmetic mean
        • Mean angle
        • Mean time of day
        • Median
        • Mode
        • Pythagorean means
        • Root mean square
        • Simple moving average
      • AVL tree
    • B
      • Bézier curves
        • Intersections
      • B-spline
      • Babbage problem
      • Babylonian spiral
      • Bacon cipher
      • Balanced brackets
      • Balanced ternary
      • Banker's algorithm
      • Barnsley fern
      • Base58Check encoding
      • Base64 decode data
      • Base64 encode data
      • Base 16 numbers needing a to f
      • Bell numbers
      • Benford's law
      • Bernoulli numbers
      • Bernstein basis polynomials
      • Best shuffle
      • Bifid cipher
      • Bilinear interpolation
      • Bin given limits
      • Binary coded decimal
      • Binary digits
      • Binary search
      • Binary strings
      • Binomial transform
      • Bioinformatics
        • Base count
        • Global alignment
        • Sequence mutation
        • Subsequence
      • Biorhythms
      • Birthday problem
      • Bitcoin
        • Address validation
        • Public point to address
      • Bitmap
        • Bézier curves
          • Cubic
          • Quadratic
        • Bresenham's line algorithm
        • Flood fill
        • Histogram
        • Midpoint circle algorithm
        • PPM conversion through a pipe
        • Read a PPM file
        • Read an image through a pipe
        • Write a PPM file
      • Bitwise IO
      • Bitwise operations
      • Blum integer
      • Boolean values
      • Boustrophedon transform
      • Box the compass
      • Boyer-Moore string search
      • Brace expansion
      • Brace expansion using ranges
      • Brazilian numbers
      • Break OO privacy
      • Brilliant numbers
      • Brownian tree
      • Bulls and cows
        • Player
      • Burrows Wheeler transform
    • C
      • Caesar cipher
      • Calculating the value of e
      • Calendar
      • Calendar - for REAL programmers
      • Calkin-Wilf sequence
      • Call a foreign-language function
      • Call a function
      • Call a function in a shared library
      • Call an object method
      • Calmo numbers
      • CalmoSoft primes
      • Camel case and snake case
      • Canny edge detector
      • Canonicalize CIDR
      • Cantor set
      • Card shuffles
      • Carmichael 3 strong pseudoprimes
      • Carmichael lambda function
      • Cartesian product of two or more lists
      • Case-sensitivity of identifiers
      • Casting out nines
      • Catalan numbers
        • Pascal's triangle
      • Catamorphism
      • Centre and radius of a circle passing through 3 points in a plane
      • Centroid of a set of N-dimensional points
      • Change e letters to i in words
      • Changeable words
      • Chaocipher
      • Chaos game
      • Character codes
      • Chat server
      • Chebyshev coefficients
      • Check if a polygon overlaps with a rectangle
      • Check if two polygons overlap
      • Check input device is a terminal
      • Check Machin-like formulas
      • Check output device is a terminal
      • Check that file exists
      • Checkpoint synchronization
      • Checksumcolor
      • Chemical calculator
      • Chernick's Carmichael numbers
      • Cheryl's birthday
      • Chinese remainder theorem
      • Chinese zodiac
      • Cholesky decomposition
      • Chowla numbers
      • Church numerals
      • Cipolla's algorithm
      • Circles of given radius through two points
      • Circular primes
      • Cistercian numerals
      • Classes
      • Closest-pair problem
      • Closures
        • Value capture
      • Code Golf Code Golf
      • Code segment unload
      • Collect and sort square numbers in ascending order from three lists
      • Collections
      • Color of a screen pixel
      • Color quantization
      • Color wheel
      • Colorful numbers
      • Colour bars
        • Display
      • Colour pinstripe
        • Display
        • Printer
      • Combinations
      • Combinations and permutations
      • Combinations with repetitions
        • Square digit chain
      • Comma quibbling
      • Command-line arguments
      • Commatizing numbers
      • Comments
      • Common list elements
      • Common sorted list
      • Compare a list of strings
      • Compare length of two strings
      • Compare sorting algorithms' performance
      • Compile-time calculation
      • Compiler
        • Code generator
        • Lexical analyzer
        • Simple file inclusion pre processor
        • Verifying syntax
        • Virtual machine interpreter
      • Composite numbers k with no single digit factors whose factors are all substrings of k
      • Compound data type
      • Concatenate two primes is also prime
      • Concurrent computing
      • Conditional structures
      • Conjugate a Latin verb
      • Conjugate transpose
      • Consecutive primes with ascending or descending differences
      • Consistent overhead byte stuffing
      • Constrained genericity
      • Constrained random points on a circle
      • Continued fraction
        • Arithmetic
          • Construct from rational number
          • Gmatrix ng continued fraction n
          • Gmatrix ng continued fraction n1 continued fraction n2
      • Continued fraction convergents
      • Convert decimal number to rational
      • Convert seconds to compound duration
      • Convex hull
      • Conway's Game of Life
      • Coprime triplets
      • Coprimes
      • Copy a string
      • Copy stdin to stdout
      • CORDIC
      • Count how many vowels and consonants occur in a string
      • Count in factors
      • Count in octal
      • Count occurrences of a substring
      • Count the coins
        • 0-1
      • Countdown
      • Cousin primes
      • Cramer's rule
      • CRC-32
      • Create a file
      • Create a file on magnetic tape
      • Create a two-dimensional array at runtime
      • Create an HTML table
      • Create an object
        • Native demonstration
      • Create an object at a given address
      • Create your own text control codes
      • CSV data manipulation
      • CSV to HTML translation
      • Cuban primes
      • Cubic special primes
      • Cullen and Woodall numbers
      • Cumulative standard deviation
      • Currency
      • Currying
      • Curve that touches three points
      • Curzon numbers
      • CUSIP
      • Cut a rectangle
      • Cycle detection
      • Cycles of a permutation
      • Cyclops numbers
      • Cyclotomic polynomial
    • D
      • Damm algorithm
      • Data Encryption Standard
      • Date format
      • Date manipulation
      • Dating agency
      • Day of the week
      • Day of the week of Christmas and New Year
      • Days between dates
      • De Bruijn sequences
      • De Polignac numbers
      • Deal cards for FreeCell
      • Death Star
      • Deceptive numbers
      • Decimal floating point number to binary
      • Decision tables
      • Deconvolution
        • 1D
        • 2D
      • Decorate-sort-undecorate idiom
      • Deepcopy
      • Define a primitive data type
      • Delegates
      • Delete a file
      • Deming's funnel
      • Department numbers
      • Descending primes
      • Detect division by zero
      • Determinant and permanent
      • Determine if a string has all the same characters
      • Determine if a string has all unique characters
      • Determine if a string is collapsible
      • Determine if a string is numeric
      • Determine if a string is squeezable
      • Determine if only one instance is running
      • Determine if two triangles overlap
      • Determine sentence type
      • Dice game probabilities
      • Digit fifth powers
      • Digital root
        • Multiplicative digital root
      • Dijkstra's algorithm
      • Dinesman's multiple-dwelling problem
      • Dining philosophers
      • Disarium numbers
      • Discordian date
      • Discrete Fourier transform
      • Display a linear combination
      • Display an outline as a nested table
      • Distance and Bearing
      • Distinct palindromes within decimal numbers
      • Distinct power numbers
      • Distributed programming
      • Distribution of 0 digits in factorial series
      • Diversity prediction theorem
      • Divide a rectangle into a number of unequal triangles
      • DNS query
      • Documentation
      • Doomsday rule
      • Dot product
      • Double Twin Primes
      • Doubly-linked list
        • Definition
        • Element definition
        • Element insertion
        • Element removal
        • Traversal
      • Dragon curve
      • Draw a clock
      • Draw a cuboid
      • Draw a pixel
      • Draw a rotating cube
      • Draw a sphere
      • Draw pixel 2
      • Duffinian numbers
      • Dutch national flag problem
      • Dynamic variable names
    • E
      • Earliest difference between prime gaps
      • Eban numbers
      • Echo server
      • Eertree
      • Egyptian division
      • Eisenstein primes
      • EKG sequence convergence
      • Element-wise operations
      • Elementary cellular automaton
        • Infinite length
        • Random number generator
      • Elliptic curve arithmetic
      • Elliptic Curve Digital Signature Algorithm
      • Emirp primes
      • Empty directory
      • Empty program
      • Empty string
      • Enforced immutability
      • Engel expansion
      • English cardinal anagrams
      • Entropy
        • Narcissist
      • Enumerations
      • Environment variables
      • Equal prime and composite sums
      • Equilibrium index
      • Erdös-Selfridge categorization of primes
      • Erdős-Nicolas numbers
      • Erdős-primes
      • Erdős Woods numbers
      • Esthetic numbers
      • Ethiopian multiplication
      • Euclid-Mullin sequence
      • Euclidean rhythm
      • Euler's constant 0 5772
      • Euler's identity
      • Euler's sum of powers conjecture
      • Euler method
      • Evaluate binomial coefficients
      • Even numbers which cannot be expressed as the sum of two twin primes
      • Even or odd
      • Events
      • Evolutionary algorithm
      • Exactly three adjacent 3 in lists
      • Exceptions
        • Catch an exception thrown in a nested call
      • Executable library
      • Execute a Markov algorithm
      • Execute a system command
      • Execute Brain****
      • Execute Computer
        • Zero
      • Execute CopyPasta Language
      • Execute HQ9
      • Execute SNUSP
      • Exponential digital sums
      • Exponentiation operator
      • Exponentiation order
      • Exponentiation with infix operators in or operating on the base
      • Extend your language
      • Extensible prime generator
      • External sort
      • Extra primes
      • Extract file extension
      • Extreme floating point values
      • Extreme primes
    • F
      • Faces from a mesh
      • Factor-perfect numbers
      • Factorial
      • Factorial base numbers indexing permutations of a collection
      • Factorial primes
      • Factorions
      • Factorize string into Lyndon words
      • Factors of a Mersenne number
      • Factors of an integer
      • Fairshare between two and more
      • Farey sequence
      • Fast Fourier transform
      • FASTA format
      • Faulhaber's formula
      • Faulhaber's triangle
      • Feigenbaum constant calculation
      • Fermat numbers
      • Fermat pseudoprimes
      • Fibonacci heap
      • Fibonacci matrix-exponentiation
      • Fibonacci n-step number sequences
      • Fibonacci sequence
      • Fibonacci word
        • Fractal
      • File extension is in extensions list
      • File input
        • Output
      • File modification time
      • File size
      • File size distribution
      • Filter
      • Find adjacent primes which differ by a square integer
      • Find Chess960 starting position identifier
      • Find common directory path
      • Find duplicate files
      • Find first and last set bit of a long integer
      • Find first missing positive
      • Find if a point is within a triangle
      • Find largest left truncatable prime in a given base
      • Find limit of recursion
      • Find minimum number of coins that make a given value
      • Find palindromic numbers in both binary and ternary bases
      • Find prime n such that reversed n is also prime
      • Find prime numbers of the form nnn 2
      • Find square difference
      • Find squares n where n 1 is prime
      • Find the intersection of a line with a plane
      • Find the intersection of two lines
      • Find the last Sunday of each month
      • Find the missing permutation
      • Find URI in text
      • Find words which contain the most consonants
      • Find words which contains all the vowels
      • Find words which contains more than 3 e vowels
      • Find words whose first and last three letters are equal
      • Find words with alternating vowels and consonants
      • Finite state machine
      • First-class functions
        • Use numbers analogously
      • First 9 prime Fibonacci number
      • First class environments
      • First perfect square in base n with n unique digits
      • First power of 2 that has leading decimal digits of 12
      • Five weekends
      • Fivenum
      • Fixed length records
      • FizzBuzz
      • Flatten a list
      • Flipping bits game
      • Flow-control structures
      • Floyd's triangle
      • Floyd-Warshall algorithm
      • Forbidden numbers
      • Forest fire
      • Fork
      • Formal power series
      • Formatted numeric output
      • Fortunate numbers
      • Forward difference
      • Four bit adder
      • Four is magic
      • Four is the number of letters in the
      • Four sides of square
      • Fractal tree
      • Fraction reduction
      • Fractran
      • French Republican calendar
      • Frobenius numbers
      • FTP
      • Function composition
      • Function definition
      • Function frequency
      • Function prototype
      • Functional coverage tree
      • Fusc sequence
    • G
      • Galton box animation
      • Gamma function
      • Gapful numbers
      • Gauss-Jordan matrix inversion
      • Gaussian elimination
      • Gaussian primes
      • General FizzBuzz
      • Generalised floating point addition
      • Generate Chess960 starting position
      • Generate lower case ASCII alphabet
      • Generate random chess position
      • Generate random numbers without repeating a value
      • Generator
        • Exponential
      • Generic swap
      • Geohash
      • Geometric algebra
      • Get system command output
      • Getting the number of decimal places
      • Giuga numbers
      • Globally replace text in several files
      • Go Fish
      • Goldbach's comet
      • Golden ratio
        • Convergence
      • Goodstein Sequence
      • Gotchas
      • Gradient descent
      • Graph colouring
      • Gray code
      • Grayscale image
      • Greatest common divisor
      • Greatest element of a list
      • Greatest prime dividing the n-th cubefree number
      • Greatest subsequential sum
      • Greed
      • Greedy algorithm for Egyptian fractions
      • Greyscale bars
        • Display
      • GSTrans string conversion
      • Guess the number
        • With feedback
        • With feedback player
      • GUI
        • Maximum window dimensions
      • GUI component interaction
      • GUI enabling
        • Disabling of controls
    • H
      • Hailstone sequence
      • Halt and catch fire
      • Hamming numbers
      • Handle a signal
      • Happy numbers
      • Harmonic series
      • Harshad or Niven series
      • Hash from two arrays
      • Hash join
      • Hashtron inference
      • Haversine formula
      • Hello world
        • Graphical
        • Line printer
        • Newbie
        • Newline omission
        • Standard error
        • Text
        • Web server
      • Here document
      • Heronian triangles
      • Hex dump
      • Hex words
      • Hickerson series of almost integers
      • Higher-order functions
      • Hilbert curve
      • History variables
      • Hofstadter-Conway 10 000 sequence
      • Hofstadter Figure-Figure sequences
      • Hofstadter Q sequence
      • Holidays related to Easter
      • Home primes
      • Honaker primes
      • Horizontal sundial calculations
      • Horner's rule for polynomial evaluation
      • Horse racing
      • Host introspection
      • Hostname
      • Hough transform
      • Hourglass puzzle
      • HTTP
      • HTTPS
        • Authenticated
        • Client-authenticated
      • Huffman coding
      • Humble numbers
      • Hunt the Wumpus
    • I
      • I'm a software engineer get me out of here
      • I before E except after C
      • IBAN
      • Iccanobif primes
      • Identity matrix
      • Idiomatically determine all the characters that can be used for symbols
      • Idiomatically determine all the lowercase and uppercase letters
      • Idoneal numbers
      • Image convolution
      • Image noise
      • Imaginary base numbers
      • Implicit type conversion
      • Include a file
      • Inconsummate numbers in base 10
      • Increasing gaps between consecutive Niven numbers
      • Increment a numerical string
      • Index finite lists of positive integers
      • Infinity
      • Inheritance
        • Multiple
        • Single
      • Inner classes
      • Input
        • Output for lines of text
        • Output for pairs of numbers
      • Input loop
      • Integer comparison
      • Integer long division
      • Integer overflow
      • Integer roots
      • Integer sequence
      • Interactive help
      • Interactive programming repl
      • Intersecting number wheels
      • Introspection
      • Inventory sequence
      • Inverted index
      • Inverted syntax
      • IPC via named pipe
      • ISBN13 check digit
      • Isograms and heterograms
      • Isqrt integer square root of X
      • Iterated digits squaring
      • Iterators
    • J
      • Jaccard index
      • Jacobi symbol
      • Jacobsthal numbers
      • Jaro-Winkler distance
      • Jaro similarity
      • Jensen's Device
      • Jewels and stones
      • Jordan-Pólya numbers
      • JortSort
      • Josephus problem
      • Joystick position
      • JSON
      • Juggler sequence
      • Julia set
      • Jump anywhere
      • Just in time processing on a character stream
    • K
      • K-d tree
      • K-means clustering
      • Kahan summation
      • Kaprekar numbers
      • Kernighans large earthquake problem
      • Keyboard input
        • Flush the keyboard buffer
        • Keypress check
        • Obtain a Y or N response
      • Keyboard macros
      • Klarner-Rado sequence
      • Knapsack problem
        • 0-1
        • Bounded
        • Continuous
        • Unbounded
      • Knight's tour
      • Knuth's algorithm S
      • Knuth's power tree
      • Knuth-Morris-Pratt string search
      • Knuth shuffle
      • Koch curve
      • Kolakoski sequence
      • Kosaraju
      • Kronecker product
      • Kronecker product based fractals
    • L
      • L-system
      • Lagrange Interpolation
      • Lah numbers
      • Langton's ant
      • Largest difference between adjacent primes
      • Largest five adjacent number
      • Largest int from concatenated ints
      • Largest number divisible by its digits
      • Largest palindrome product
      • Largest prime factor
      • Largest product in a grid
      • Largest proper divisor of n
      • Last Friday of each month
      • Last letter-first letter
      • Last list item
      • Latin Squares in reduced form
        • Randomizing using Jacobson and Matthews' technique
      • Launch rocket with countdown and acceleration in stdout
      • Law of cosines - triples
      • Leap year
      • Least common multiple
      • Least m such that n m is prime
      • Left factorials
      • Legendre prime counting function
      • Length of an arc between two angles
      • Leonardo numbers
      • Letter frequency
      • Levenshtein distance
        • Alignment
      • Line circle intersection
      • Linear congruential generator
      • Linux CPU utilization
      • List comprehensions
      • List rooted trees
      • Literals
        • Floating point
        • Integer
        • String
      • Logical operations
      • Logistic curve fitting in epidemiology
      • Long literals with continuations
      • Long multiplication
      • Long primes
      • Long stairs
      • Long year
      • Longest common prefix
      • Longest common subsequence
      • Longest common substring
      • Longest common suffix
      • Longest increasing subsequence
      • Longest palindromic substrings
      • Longest string challenge
      • Longest substrings without repeating characters
      • Look-and-say sequence
      • Loop over multiple arrays simultaneously
      • Loops
        • Break
        • Continue
        • Do-while
        • Downward for
        • For
        • For with a specified step
        • Foreach
        • Increment loop index within loop body
        • Infinite
        • N plus one half
        • Nested
        • While
        • With multiple ranges
        • Wrong ranges
      • LU decomposition
      • Lucas-Carmichael numbers
      • Lucas-Lehmer test
      • Lucky and even lucky numbers
      • Ludic numbers
      • Luhn test of credit card numbers
      • Lychrel numbers
      • Lyndon word
      • LZW compression
    • M
      • Möbius function
      • MAC vendor lookup
      • Machine code
      • Mad Libs
      • Magic 8-ball
      • Magic constant
      • Magic numbers
      • Magic squares of doubly even order
      • Magic squares of odd order
      • Magic squares of singly even order
      • Magnanimous numbers
      • Main step of GOST 28147-89
      • Make a backup file
      • Make directory path
      • Man or boy test
      • Mandelbrot set
      • Map range
      • Marching squares
      • Markov chain text generator
      • Mastermind
      • Matrix-exponentiation operator
      • Matrix chain multiplication
      • Matrix digital rain
      • Matrix multiplication
      • Matrix transposition
      • Matrix with two diagonals
      • Maximum difference between adjacent elements of list
      • Maximum triangle path sum
      • Mayan calendar
      • Mayan numerals
      • Maze generation
      • Maze solving
      • McNuggets problem
      • MD4
      • MD5
        • Implementation
      • Median filter
      • Meissel Mertens constant
      • Memory allocation
      • Memory layout of a data structure
      • Menu
      • Merge and aggregate datasets
      • Mersenne primes
      • Mertens function
      • Metallic ratios
      • Metaprogramming
      • Metered concurrency
      • Metronome
      • Mian-Chowla sequence
      • Middle three digits
      • Miller Rabin primality test
      • Mind boggling card trick
      • Minesweeper game
      • Minimal steps down to 1
      • Minimum multiple of m where digital sum equals m
      • Minimum number of cells after before above and below NxN squares
      • Minimum numbers of three lists
      • Minimum positive multiple in base 10 using only 0 and 1
      • Minimum primes
      • Minkowski question-mark function
      • Modified random distribution
      • Modular arithmetic
      • Modular exponentiation
      • Modular inverse
      • Modulinos
      • Monads
        • List monad
        • Maybe monad
        • Writer monad
      • Monte Carlo methods
      • Montgomery reduction
      • Monty Hall problem
      • Morse code
      • Mosaic matrix
      • Most frequent k chars distance
      • Motzkin numbers
      • Mouse position
      • Move-to-front algorithm
      • Multi-base primes
      • Multi-dimensional array
      • Multidimensional Newton-Raphson method
      • Multifactorial
      • Multiline shebang
      • Multiple distinct objects
      • Multiple regression
      • Multiplication tables
      • Multiplicative order
      • Multiplicatively perfect numbers
      • Multisplit
      • Multiton
      • Munchausen numbers
      • Munching squares
      • Musical scale
      • Mutex
      • Mutual recursion
    • N
      • N'th
      • N-body problem
      • N-grams
      • N-queens minimum and knights and bishops
      • N-queens problem
      • N-smooth numbers
      • Named parameters
      • Names to numbers
      • Naming conventions
      • Narcissist
      • Narcissistic decimal number
      • Native shebang
      • Natural sorting
      • Nautical bell
      • Negative base numbers
      • Neighbour primes
      • Nested function
      • Nested templated data
      • Next highest int from digits
      • Next special primes
      • Nice primes
      • Nim game
      • Nimber arithmetic
      • Non-continuous subsequences
      • Non-decimal radices
        • Convert
        • Input
        • Output
      • Non-transitive dice
      • Nonoblock
      • Nonogram solver
      • Nth root
      • Null object
      • Number names
      • Number reversal game
      • Numbers divisible by their individual digits but not by the product of their digits
      • Numbers in base-16 representation that cannot be written with decimal digits
      • Numbers in base 10 that are palindromic in bases 2 4 and 16
      • Numbers k such that the last letter of k is the same as the first letter of k 1
      • Numbers which are not the sum of distinct squares
      • Numbers which are the cube roots of the product of their proper divisors
      • Numbers whose binary and ternary digit sums are prime
      • Numbers whose count of divisors is prime
      • Numbers with equal rises and falls
      • Numbers with prime digits whose sum is 13
      • Numbers with same digit set in base 10 and base 16
      • Numeric error propagation
      • Numeric separator syntax
      • Numerical and alphabetical suffixes
      • Numerical integration
        • Adaptive Simpson's method
        • Gauss-Legendre Quadrature
      • NYSIIS
    • O
      • O'Halloran numbers
      • Object serialization
      • Odd and square numbers
      • Odd squarefree semiprimes
      • Odd word problem
      • Odd words
      • Old lady swallowed a fly
      • Old Russian measure of length
      • One-dimensional cellular automata
      • One-time pad
      • One-two primes
      • One of n lines in a file
      • OpenGL
        • Utah teapot
      • OpenWebNet password
      • Operator precedence
      • Optional parameters
      • Orbital elements
      • Order by pair comparisons
      • Order disjoint list items
      • Order two numerical lists
      • Ordered partitions
      • Ordered words
      • Ormiston pairs
      • Ormiston triples
      • Overloaded operators
      • Own digits power sum
    • P
      • P-Adic numbers basic
      • P-value correction
      • Padovan n-step number sequences
      • Padovan sequence
      • Pairs with common factors
      • Palindrome dates
      • Palindrome detection
      • Palindromic gapful numbers
      • Palindromic primes
      • Palindromic primes in base 16
      • Pan base non-primes
      • Pancake numbers
      • Pandigital prime
      • Pangram checker
      • Paraffins
      • Parallel brute force
      • Parallel calculations
      • Parameterized SQL statement
      • Parametric polymorphism
      • Parse an IP Address
      • Parse command-line arguments
      • Parse EBNF
      • Parsing
        • RPN calculator algorithm
        • RPN to infix conversion
        • Shunting-yard algorithm
      • Partial function application
      • Particle fountain
      • Particle swarm optimization
      • Partition an integer x into n primes
      • Partition function P
      • Pascal's triangle
        • Puzzle
      • Pascal matrix generation
      • Password generator
      • Pathological floating point problems
      • Peaceful chess queen armies
      • Peano curve
      • Pell's equation
      • Pell numbers
      • Penholodigital squares
      • Penney's game
      • Penrose tiling
      • Penta-power prime seeds
      • Pentagram
      • Pentomino tiling
      • Percentage difference between images
      • Perceptron
      • Percolation
        • Bond percolation
        • Mean cluster density
        • Mean run density
        • Site percolation
      • Perfect numbers
      • Perfect shuffle
      • Perfect totient numbers
      • Periodic table
      • Peripheral drift illusion
      • Perlin noise
      • Permutation test
      • Permutations
        • Derangements
        • Rank of a permutation
      • Permutations by swapping
      • Permutations with repetitions
      • Permutations with some identical elements
      • Permuted multiples
      • Pernicious numbers
      • Phrase reversals
      • Pi
      • Pick random element
      • Pierpont primes
      • Pig the dice game
        • Player
      • Pinstripe
        • Display
        • Printer
      • Piprimes
      • Pisano period
      • Plasma effect
      • Playfair cipher
      • Playing cards
      • Plot coordinate pairs
      • Pointers and references
      • Poker hand analyser
      • Polymorphic copy
      • Polymorphism
      • Polynomial derivative
      • Polynomial long division
      • Polynomial regression
      • Polynomial synthetic division
      • Polyspiral
      • Population count
      • Posit numbers
        • Decoding
        • Encoding
      • Positive decimal integers with the digit 1 occurring exactly twice
      • Power set
      • Powerful numbers
      • Practical numbers
      • Pragmatic directives
      • Price fraction
      • Price list behind API
      • Primality by trial division
      • Primality by Wilson's theorem
      • Prime conspiracy
      • Prime decomposition
      • Prime numbers p for which the sum of primes less than or equal to p is prime
      • Prime numbers which contain 123
      • Prime numbers whose neighboring pairs are tetraprimes
      • Prime reciprocal sum
      • Prime triangle
      • Prime triplets
      • Prime words
      • Primes - allocate descendants to their ancestors
      • Primes n*2 m 1
      • Primes which contain only one odd digit
      • Primes whose first and last number is 3
      • Primes whose sum of digits is 25
      • Primes with digits in nondecreasing order
      • Primorial numbers
      • Print debugging statement
      • Print itself
      • Priority queue
      • Probabilistic choice
      • Problem of Apollonius
      • Process SMIL directives in XML data
      • Product of divisors
      • Product of min and max prime factors
      • Program name
      • Program termination
      • Proof
      • Proper divisors
      • Pseudo-random numbers
        • Combined recursive generator MRG32k3a
        • Middle-square method
        • PCG32
        • Splitmix64
        • Xorshift star
      • Pseudorandom number generator image
      • Pythagoras tree
      • Pythagorean quadruples
      • Pythagorean triples
    • Q
      • QR decomposition
      • Quad-power prime seeds
      • Quadrat special primes
      • Quaternion type
      • Queue
        • Definition
        • Usage
      • Quickselect algorithm
      • Quine
      • Quoting constructs
    • R
      • Radical of an integer
      • Railway circuit
      • Rainbow
      • Ramanujan's constant
      • Ramanujan primes
        • Twins
      • Ramer-Douglas-Peucker line simplification
      • Ramsey's theorem
      • Random Latin squares
      • Random number generator device
      • Random number generator included
      • Random numbers
      • Random sentence from book
      • Range consolidation
      • Range expansion
      • Range extraction
      • Range modifications
      • Ranking methods
      • Rare numbers
      • Raster bars
      • Rate counter
      • Ray-casting algorithm
      • RCRPG
      • Read a configuration file
      • Read a file character by character
        • UTF8
      • Read a file line by line
      • Read a specific line from a file
      • Read entire file
      • Readline interface
      • Real constants and functions
      • Recaman's sequence
      • Record sound
      • Recursive descent parser generator
      • Reduced row echelon form
      • Reflection
        • Get source
        • List methods
        • List properties
      • Regular expressions
      • Remove duplicate elements
      • Remove lines from a file
      • Remove vowels from a string
      • Rename a file
      • Rendezvous
      • Rep-string
      • Repeat
      • Repeat a string
      • Repunit primes
      • Resistance calculator
      • Resistance network calculator
      • Resistor mesh
      • Respond to an unknown method call
      • Retrieve and search chat history
      • Return multiple values
      • Reverse a string
      • Reverse the gender of a string
      • Reverse the order of lines in a text file while preserving the contents of each line
      • Reverse words in a string
      • Rhonda numbers
      • Rice coding
      • Riordan numbers
      • RIPEMD-160
      • Robots
      • Rock-paper-scissors
      • Rodrigues rotation formula
      • Roman numerals
        • Decode
        • Encode
      • Roots of a cubic polynomial
      • Roots of a function
      • Roots of a quadratic function
      • Roots of unity
      • Rosetta Code
        • Count examples
        • Find bare lang tags
        • Find unimplemented tasks
        • Fix code tags
        • List authors of task descriptions
        • Rank languages by number of users
        • Rank languages by popularity
        • Run examples
        • Tasks without examples
      • Rot-13
      • Round-robin tournament schedule
      • RPG attributes generator
      • RSA code
      • Run-length encoding
      • Run as a daemon or service
      • Runge-Kutta method
      • Runtime evaluation
        • In an environment
      • Ruth-Aaron numbers
    • S
      • S-expressions
      • Safe addition
      • Safe and Sophie Germain primes
      • Safe mode
      • Safe primes and unsafe primes
      • Sailors coconuts and a monkey problem
      • Same fringe
      • Sanitize user input
      • Sattolo cycle
      • Scope
        • Function names and labels
      • Scope modifiers
      • Sealed classes and methods
      • Search a list
      • Search a list of records
      • Search in paragraph's text
      • Secure temporary file
      • SEDOLs
      • Segmentation fault protection
      • Selection bias in clinical sciences
      • Selective file copy
      • Selectively replace multiple instances of a character within a string
      • Self-describing numbers
      • Self-hosting compiler
      • Self numbers
      • Semiprime
      • Semordnilap
      • Send an unknown method call
      • Send email
      • SEND MORE MONEY
      • Separate the house number from the street name
      • Sequence nth number with exactly n divisors
      • Sequence of non-squares
      • Sequence of primes by trial division
      • Sequence of primorial primes
      • Sequence smallest number greater than previous term with exactly n divisors
      • Sequence smallest number with exactly n divisors
      • Set
      • Set consolidation
      • Set of real numbers
      • Set puzzle
      • Set right-adjacent bits
      • Set the card game
      • Seven-sided dice from five-sided dice
      • Sexy primes
      • SHA-1
      • SHA-256
      • SHA-256 Merkle tree
      • Shell one-liner
      • Shift list elements to left by 3
      • Shoelace formula for polygonal area
      • Short-circuit evaluation
      • Shortest common supersequence
      • Show ASCII table
      • Show the decimal value of a number of 1s appended with a 3 then squared
      • Show the epoch
      • Sierpinski arrowhead curve
      • Sierpinski carpet
      • Sierpinski curve
      • Sierpinski pentagon
      • Sierpinski square curve
      • Sierpinski triangle
        • Graphical
      • Sieve of Eratosthenes
      • Sieve of Pritchard
      • Simple database
      • Simple windowed application
      • Simulate input
        • Keyboard
        • Mouse
      • Simulated annealing
      • Sine wave
      • Singleton
      • Singly-linked list
        • Element definition
        • Element insertion
        • Element removal
        • Reversal
        • Traversal
      • Singular value decomposition
      • Sisyphus sequence
      • Sleep
      • Sleeping Beauty problem
      • Smallest enclosing circle problem
      • Smallest multiple
      • Smallest number k such that k 2 m is composite for all m less than k
      • Smallest numbers
      • Smallest power of 6 whose decimal expansion contains n
      • Smallest square that begins with n
      • Smarandache-Wellin primes
      • Smarandache prime-digital sequence
      • Smith numbers
      • Snake
      • Snake and ladder
      • SOAP
      • Sockets
      • Sokoban
      • Soloway's recurring rainfall
      • Solve a Hidato puzzle
      • Solve a Holy Knight's tour
      • Solve a Hopido puzzle
      • Solve a Numbrix puzzle
      • Solve a Rubik's cube
      • Solve equations with substitution method
      • Solve hanging lantern problem
      • Solve the no connection puzzle
      • Solve triangle solitaire puzzle
      • Sorensen Dice coefficient
      • Sort a list of object identifiers
      • Sort an array of composite structures
      • Sort an integer array
      • Sort an outline at every level
      • Sort disjoint sublist
      • Sort numbers lexicographically
      • Sort primes from list to a list
      • Sort stability
      • Sort the letters of string in alphabetical order
      • Sort three variables
      • Sort using a custom comparator
      • Sorting algorithms
        • Bead sort
        • Bogosort
        • Bubble sort
        • Circle Sort
        • Cocktail sort
        • Cocktail sort with shifting bounds
        • Comb sort
        • Counting sort
        • Cycle sort
        • Gnome sort
        • Heapsort
        • Insertion sort
        • Merge sort
        • Pancake sort
        • Patience sort
        • Permutation sort
        • Quicksort
        • Radix sort
        • Selection sort
        • Shell sort
        • Sleep sort
        • Stooge sort
        • Strand sort
        • Tree sort on a linked list
      • Soundex
      • Sparkline in unicode
      • Special characters
      • Special divisors
      • Special factorials
      • Special neighbor primes
      • Special pythagorean triplet
      • Special variables
      • Speech synthesis
      • Spelling of ordinal numbers
      • Sphenic numbers
      • Spinning rod animation
        • Text
      • Spiral matrix
      • Split a character string based on change of character
      • Spoof game
      • SQL-based authentication
      • Square-free integers
      • Square but not cube
      • Square form factorization
      • Square root by hand
      • Stable marriage problem
      • Stack
      • Stack traces
      • Stair-climbing puzzle
      • Start from a main routine
      • Starting a web browser
      • State name puzzle
      • Statistics
        • Basic
        • Chi-squared distribution
        • Normal distribution
      • Steady squares
      • Steffensen's method
      • Stem-and-leaf plot
      • Stern-Brocot sequence
      • Stirling numbers of the first kind
      • Stirling numbers of the second kind
      • Straddling checkerboard
      • Strange numbers
      • Strange plus numbers
      • Strange unique prime triplets
      • Strassen's algorithm
      • Stream merge
      • String append
      • String case
      • String comparison
      • String concatenation
      • String interpolation included
      • String length
      • String matching
      • String prepend
      • Strip a set of characters from a string
      • Strip block comments
      • Strip comments from a string
      • Strip control codes and extended characters from a string
      • Strip whitespace from a string
        • Top and tail
      • Strong and weak primes
      • Sturmian word
      • Sub-unit squares
      • Subleq
      • Subset sum problem
      • Substitution cipher
      • Substring
        • Top and tail
      • Substring primes
      • Subtractive generator
      • Successive prime differences
      • Sudan function
      • Sudoku
      • Suffix tree
      • Suffixation of decimal numbers
      • Sum and product of an array
      • Sum and product puzzle
      • Sum data type
      • Sum digits of an integer
      • Sum multiples of 3 and 5
      • Sum of a series
      • Sum of divisors
      • Sum of elements below main diagonal of matrix
      • Sum of first n cubes
      • Sum of primes in odd positions is prime
      • Sum of square and cube digits of an integer are primes
      • Sum of squares
      • Sum of the digits of n is substring of n
      • Sum of two adjacent numbers are primes
      • Sum to 100
      • Summarize and say sequence
      • Summarize primes
      • Summation of primes
      • Sunflower fractal
      • Super-d numbers
      • Super-Poulet numbers
      • Superellipse
      • Superpermutation minimisation
      • Sutherland-Hodgman polygon clipping
      • Sylvester's sequence
      • Symmetric difference
      • Sync subtitles
      • Synchronous concurrency
      • System time
      • Szymański's algorithm
    • T
      • Table creation
        • Postal addresses
      • Take notes on the command line
      • Tarjan
      • Tau function
      • Tau number
      • Taxicab numbers
      • Teacup rim text
      • Temperature conversion
      • Terminal control
        • Clear the screen
        • Coloured text
        • Cursor movement
        • Cursor positioning
        • Dimensions
        • Display an extended character
        • Hiding the cursor
        • Inverse video
        • Positional read
        • Preserve screen
        • Restricted width positional input
          • No wrapping
          • With wrapping
        • Ringing the terminal bell
        • Unicode output
      • Ternary logic
      • Test a function
      • Test integerness
      • Text between
      • Text completion
      • Text processing
        • 1
        • 2
        • Max licenses in use
      • Text to HTML
      • Textonyms
      • The ISAAC cipher
      • The Name Game
      • The sieve of Sundaram
      • The Twelve Days of Christmas
      • Thiele's interpolation formula
      • Three word location
      • Thue-Morse
      • Tic-tac-toe
      • Time-based one-time password algorithm
      • Time a function
      • Tokenize a string
      • Tokenize a string with escaping
      • Tonelli-Shanks algorithm
      • Top rank per group
      • Topic variable
      • Topological sort
        • Extracted top item
      • Topswops
      • Total circles area
      • Totient function
      • Towers of Hanoi
      • Trabb Pardo Knuth algorithm
      • Transliterate English text using the Greek alphabet
      • Transportation problem
      • Tree datastructures
      • Tree from nesting levels
      • Tree traversal
      • Triangular numbers
      • Trigonometric functions
      • Triplet of three numbers
      • Tropical algebra overloading
      • Truncatable primes
      • Truncate a file
      • Truth table
      • Twelve statements
      • Twin primes
      • Two's complement
      • Two bullet roulette
      • Two identical strings
      • Two sum
      • Type detection
    • U
      • Ulam numbers
      • Ulam spiral for primes
      • Ultra useful primes
      • Unbias a random generator
      • Undefined values
      • Undulating numbers
      • Unicode strings
      • Unicode variable names
      • Unique characters
      • Unique characters in each string
      • Unit testing
      • Universal Turing machine
      • Unix
        • Ls
      • Unprimeable numbers
      • Untouchable numbers
      • Untrusted environment
      • UPC
      • Update a configuration file
      • Upside-down numbers
      • URL decoding
      • URL encoding
      • URL parser
      • URL shortener
      • Use another language to call a function
      • Useless instructions
      • User defined pipe and redirection operators
      • User input
        • Graphical
        • Text
      • Using a speech engine to highlight words
      • UTF-8 encode and decode
    • V
      • Validate International Securities Identification Number
      • Vampire number
      • Van der Corput sequence
      • Van Eck sequence
      • Variable-length quantity
      • Variable declaration reset
      • Variable size
        • Get
        • Set
      • Variables
      • Variadic function
      • Vector
      • Vector products
      • Verhoeff algorithm
      • Verify distribution uniformity
        • Chi-squared test
        • Naive
      • Vibrating rectangles
      • Video display modes
      • Vidir
      • Vigenère cipher
        • Cryptanalysis
      • Visitor pattern
      • Visualize a tree
      • VList
      • Vogel's approximation method
      • Voronoi diagram
    • W
      • Wagstaff primes
      • Walk a directory
        • Non-recursively
        • Recursively
      • Walsh matrix
      • War card game
      • Wasteful equidigital and frugal numbers
      • Water collected between towers
      • Wave function collapse
      • Waveform analysis
        • Doh ray me
      • Web scraping
      • Weird numbers
      • Welch's t-test
      • Wieferich primes
      • WiktionaryDumps to words
      • Wilson primes of order n
      • Window creation
        • X11
      • Window management
      • Wireworld
      • Wolstenholme numbers
      • Word break problem
      • Word frequency
      • Word ladder
      • Word search
      • Word wheel
      • Word wrap
      • Wordiff
      • Wordle comparison
      • Words containing the substring
      • Words from neighbour ones
      • World Cup group stage
      • Worthwhile task shaving
      • Write entire file
      • Write float arrays to a text file
      • Write language name in 3D ASCII
      • Write to Windows event log
    • X
      • Xiaolin Wu's line algorithm
      • XML
        • DOM serialization
        • Input
        • Output
        • XPath
      • XML validation
      • XXXX redacted
    • Y
      • Y combinator
      • Yahoo search interface
      • Yellowstone sequence
      • Yin and yang
    • Z
      • Zebra puzzle
      • Zeckendorf arithmetic
      • Zeckendorf number representation
      • Zero to the zero power
      • Zhang-Suen thinning algorithm
      • Zig-zag matrix
      • Zsigmondy numbers
      • Zumkeller numbers
  • The End
Powered by GitBook
On this page

Was this helpful?

  1. Programming tasks
  2. B
  3. Bioinformatics

Sequence mutation

Unweighted mutations at this point. The mutated DNA strand has a "diff" operation performed on it which (in this specific case) renders the mutated base in lower case so it may be picked out more easily.

my @bases = <A C G T>;

# The DNA strand
my $dna = @bases.roll(200).join;


# The Task
put "ORIGINAL DNA STRAND:";
put pretty $dna;
put "\nTotal bases: ", +my $bases = $dna.comb.Bag;
put $bases.sort( ~*.key ).join: "\n";

put "\nMUTATED DNA STRAND:";
my $mutate = $dna.&mutate(10);
put pretty diff $dna, $mutate;
put "\nTotal bases: ", +my $mutated = $mutate.comb.Bag;
put $mutated.sort( ~*.key ).join: "\n";


# Helper subs
sub pretty ($string, $wrap = 50) {
    $string.comb($wrap).map( { sprintf "%8d: %s", $++ * $wrap, $_ } ).join: "\n"
}

sub mutate ($dna is copy, $count = 1) {
    $dna.substr-rw((^$dna.chars).roll, 1) = @bases.roll for ^$count;
    $dna
}

sub diff ($orig, $repl) {
    ($orig.comb Z $repl.comb).map( -> ($o, $r) { $o eq $r ?? $o !! $r.lc }).join
}

Output:

ORIGINAL DNA STRAND:
       0: ACGGATAGACCGTTCCTGCAAGCTGGTACGGTTCGAATGTTGACCTTATT
      50: CTCCGCAGCGCACTACCCGATCGGGTAACGTACTCTATATGATGCCTATT
     100: TTCCCCGCCTTACATCGGCGATCAATGTTCTTTTACGCTAACTAGGCGCA
     150: CGTCGTGCCTTACCGAGAGCCAGTTCGAAATCGTGCTGAAAATATCTGGA

Total bases: 200
A       45
C       55
G       45
T       55

MUTATED DNA STRAND:
       0: ACGGATAGcCCGTTCCTGCAAGCTGGTACGGTTCGAATGTTGACCTTATT
      50: CTCCGCAGCGCACTACCCGATCGGGTcACtcACTCTATATGAcGCCTAaT
     100: TTCCCCGCCTTACATCGGCGATCAATGTTCTTTTACGCTAACTAGGCGCA
     150: CGTCGTGCCTTACCcAGAGCCAGTTCGAAATCGTGCTGAAAATATCTGGA

Total bases: 200
A       44
C       60
G       43
T       53
PreviousGlobal alignmentNextSubsequence

Last updated 1 year ago

Was this helpful?